// PROJECT 01

DNA (C)ODE:
Preserving Icons in Nucleic Acid.

Santa Claus rendered in DNA Spiral

// 01. The Concept

DNA (C)ODE explores the intersection of ephemeral digital culture and the permanence of biological storage. The project takes an iconic image of consumption—Santa Claus—and transcodes it into the most stable storage medium known to nature: synthetic DNA.

In a digital era where files corrupt, formats become obsolete, and servers are wiped, biological data offers a theoretical lifespan of thousands of years. By translating a fleeting cultural meme into the building blocks of life (A, C, G, T), the image is effectively "fossilized" for a post-digital future.

Close up of the DNA Helix letters

// 02. The Process: Spiral Scan

The transcoding process rejects the traditional linear raster of digital screens (left-to-right, top-to-bottom). Instead, a custom Spiral Scan algorithm reads the image from the center outward, mimicking natural growth patterns found in shells and galaxies.

Every pixel is analyzed for color and intensity and translated into a specific DNA base: Adenine, Cytosine, Guanine, or Thymine. The resulting artwork is not a representation; the letters are the data. It is a readable sequence that exists simultaneously as a visual portrait and a scientific artifact.

> SPIRAL SCAN source santa.png points=20237
TGATGAACTCCTTGAGGAGGATGCAGGGGGGCGGCGCGGGGGAGGTGGCGCTGCT
TCTTGTTATGCTCCTAGTAGTCATCAGCTGGTGCTGTTGATGATGCTGCTGTTGT
TGTTGTTCGTCCTCCGCCCGCCTGCTTGCAGGGCCTCGGCCGCCACCACCTCCTC
... [SEQUENCE TRUNCATED]

// 03. Selected Outputs

The Spiral Scan framework allows for various forms of visual synthesis. Below are iterations exploring portraiture and time-based generation.

DNA Transcoding of Keira Fig 1. Subject: Keira. 45,000 bp sequence.
Fig 2. Generative Synthesis Process (Video Loop)

// 04. Synthesis Specification

The generated sequence is compatible with industry-standard FASTA/GenBank formats, making it theoretically synthesizable into physical DNA strands.

60,711 bp
Linear dsDNA
55.9%
40.07 MDa
Spiral Scan (Center-Out)
Synthesizable Artifact